Most of who we are is locked into our personal DNA when we are conceived and formed in the womb. They I think Occam would have told him the simplest method was not to mess with the numbers at all. Alchemys air, fire and water correspond to nitrogen, hydrogen and oxygen because 79% of air is nitrogen, 71% of the sun is hydrogen, and 89% of water is oxygen. Encoded within these elements is an amazing blueprint of life that proves the Creator has put His own unique stamp upon every person. Natural DNA is called God DNA because Scientists havent found the actual superintelligence behind this Grand Design. My Alkaline Vegan Journey | DNA Literal Translation | God Eternal within the body original sound - My Alkaline Vegan Journey. NAA DNA UCHOVVA DLEIT POSOLSTVO - BOH VEN V TELI - ODHADEN ZDIEAJTE Pripojte sa QAnon Warriors OUR DNA HOLDS A IMPORTANT MESSAGE - GOD ETERNAL WITHIN THE BODY - REVEALED SHARE Join QAnon Warriors : Rockefeller sa te z 11. thousands and thousands of different Just as DNA has four While he was doing some cross-referencing of the patterns on a whim with alanguage database to see if he could establish the codes meaning, the team wassurprised to find that the patterns corresponded to the ancient language that Jesus spoke in His daily life Aramaic. by the letters A, T, C, and G. of Gods role as an intelligent As the 4 bases Adenine(A), Thymine(T), Guanine(G) and Cytosine(C) are the building blocks of any DNA of any organism. are read to assemble proteins. the DNA genome code and GOD Gene written into the very fabric of Life within our blood molecular structure that states, GOD Eternal within the Body. The coding is built from four different molecules that combine in various ways. hidden codes that have a practical function and purpose in So, it proves that God exists until wwe dont find the actual reason. The Bible Code found amazing messages by forming grids of various dimensions from the Hebrew text and looking for words in all directions as in a wordsearch grid. Crick proposed a model of God DNA in 1953. letter, it means something completely different in French. left to discover? We arent god. They form the letters Y-H-W-H which is the name of God. Scientists dont even know Who makes DNA? So, think of some intelligent creator. to understand DNA is by a comparison 94 views, and only a couple of responses doesn't quite seem right so 20 minutes into the video we finally get to the question and well.. there really wasn't much in it at all. So the evolutionary That is the reason why a child has many characteristics similar to his or her parents. The process which is really just a matter of copying and pasting is explained by T. Wakayama et al., in the July 1998 issue of Nature:. Now we know that this basic Surely Yes, DNA proves the existence of an intelligent designer because it is such a complex and extremely long Code that needs a super intelligent designer for its Grand Design. Most DNA is located in the cell nucleus (where it is called nuclear DNA), but a small amount of DNA can also be found in the mitochondria (where it is called mitochondrial DNA . Mankind is fearfully and wonderfully made, with a hidden code within the cell of every life. [1][2] Translating a Known Scientific Language with an Ancient Spiritual Message Each alphabet letter in the human DNA strand reveals an important scientific and spiritual message for each of us to know and . just one purpose. Amazing! She is the author of Women Arent Supposed to Fly: The Memoirs of a Female Flight Surgeon and co-author of the textbook, Consumer Health: A Guide to Intelligent Decisions. The darkness of chet is too much. How many more are Left alone, this spark will diminish and burn low through seeking pleasure in worldly desires. for forming proteins (the building God DNA Helix is like a spiral staircase taking a complete turn after every 34 A. First layer of the message in our cells: God/Eternal within the body. DNA code: In the same way, DNA is made up of four chemicals, abbreviated as letters A, T, G, and C. Much like the ones and zeros, these letters are arranged in the human cell like this: CGTGTGACTCGCTCCTGAT and so on. He asks typical Creationist questions. Copyright Gregg Braden Gregg Braden has discovered a coded message that is present in every living cell of every creature on earth. It was the spirit of YHWH that first moved over the face of the earth. the Human Genome Project Since DNA usually doesnt He says it is unlikely that natural processes could account for this, but geneticists know this sort of thing happens frequently. hallmark of incredible design. Until recently cells. Scientists get convinced of the presence of God until they wouldnt find the secret intelligence of the DNA. Yahshua bridges the gap between YHWH and our souls. DNA storage can squeeze all that information into a ping-pong ball, with room to spare. It couldnt be written naturally by chance or through sea waves. Some features of ATS will be disabled while you continue to use an ad-blocker. Many people around the world do not believe that God exists, classifying themselves as atheists. Scientists have now Imagine a pure light inside of every person in the world; this is the neshamah. Both the God DNA and Natural DNA are the same thing. Tech. Rather, its through the very name that YHWH divulged to Moses over three millennia ago that our world and the foundation of life itself became possible. Come to think of it, I suppose if we gave up eating all animals and plants, human conflicts would end pretty quickly. experiments on pea plants Simple is good. YHWH offers His salvation, His deliverance through the person of Yahshua. Wow did Jesus change and upgrade our DNA code 2000 years ago and were just now finding out about it, Just Bieber Encourages Fans to Turn to Jesus When, The Devils Plan For America, Pray Before Watching, The Miraculous Image of Jesus Seen Walking Among the Flames, The Cross Remains Untouched Among The Notre-Dame Blaze, God Provides Even in The Tragic Fire of Notre Dame, 4-Year-Old With The Voice Of An Angel Sings Beautiful, MS-13 Street Gangs Shaken by the Holy Spirit in Prison. Is it a superintelligence who created this Grand Design? in codons or in genes, the Made By Using this methodology, he was able to break the code and reveal the message contained within our cells: "God eternal within the body." Braden said the message reads the same in biblical Hebrew, ancient Arabic and Sanskrit, and estimated the odds of this occurring naturally at 1 in 256,000. The Sepher Yetzirah describes this nonphysical form of YHWHs presence as the Breath of YHWH: Ten Sefirot of Nothingness: One is the Breath of the Living YHWH, Life of worlds. With each milestone achievement a new instruction set is unlocked; sort of like a treasure hunt whereby when one's character, competence, capability and judgment matures to a certain level, a new level of development is unlocked, and so on. The book of First John clarifies this. Sympathetic Resonance Technology: scientific foundation and summary of biologic and clinical studies. He thinks that what we call evolution is really just adaptation, and that evolution cant explain our origin. INFORMATION FROM DNA To obey the precepts of Torah is to stay on the straight and narrow road of redemption. To assimilate the time sphere of influences needing to shift our life in unconscious means over the source creator's way; inner love spiritual entanglement. Scientists working for This Gun Could Reach Space | Know it Why? DNA stands for DeoxyriboNucleic Acid. In our DNA = "God eternal within the body" https://youtu.be/jMtt8Wvm1NM Gregg Braden keeps digging. We are indeed the story-telling species, and Braden has created an engaging tall tale. The original angelic human 12 Strand DNA is called the Diamond Sun DNA. A, T, G and C. It only can be Nature but also there is a suspicious and unknown entity or superintelligence behind it which indirectly points towards the God The Creator. The KJV says, Sing praises to his name: extol him that rideth upon the heavens by his name YAH, and rejoice before him, Psalm 68:4. We just cant follow Torah enough. duons) serve this dual purpose. A, T, G and C. Yes Of Course, the consciousness can be linked to our DNA because DNA have all the data storage for: As the DNA code is so long and extremely complex. (Does combining two incomplete hypotheses usually lead to truth? "You have unique gifts that originated in your spiritual creation and that were developed during the vast span of your premortal life" (" Three Sisters ," Oct. 2017 general conference [ Ensign or Liahona, Nov. 2017, 17]). Consider this: humanity will generate an estimated 33 zettabytes of data by 2025that's 3.3 followed by 22 zeroes. Now is the time for you to tap into your limitless. The coded data contains the genetic sharing of the Father and Mothers DNA. Braden has now proved that God created man. In the same way whole functions of the body are decided by the DNA code having its copy placed inside each cell of the body. two kinds of information at once! Mankind was made in the image of YHWH. letters, these letters are combined what they mean here at all. The soul code of DNA links man to YHWH. The sequence is 10 (yud), 5 (heh), 6 (vav/ waw), and 5 (heh)10-5-6-5, YHWH, just as Dr. Rubenstein said. One possibility is Thats why a child has many similar characteristics to their parents. The Scriptures translate neshamah as breath, spirit, and inspiration. It is the supernal soul of man, which pulls man towards YHWH. In order to follow Bradens reasoning, you are expected to swallow the science of gematria whole. The evidence is so clear that people are COPYRIGHT 2020- 2023 SPACEUPPER. In the Sepher Yetzirahs mysterious 231 mystical gates of creation, GV represents DM, or the root of the word Adam. But also believing nature means believing unknown superintelligence. (With the possible exception of breatharians). Its instructions are written by different sequences and arrangements of those 4 letters. Its only desire is to return to its source; to be reunited in purpose. .. What is coded in our DNA is "God eternal within the body". Hidden codes are a great testimony Now share it peacefully with the world ~ The researchers couldnt come up with any persuasive explanation that it wasnt the one and only Jesus Christ. Nearly every cell in a person's body has the same DNA. We have His name written upon our very DNA. the instructions are read to assemble YHWHs name is in every person there isone YHWH and Father of all, who is over all and through all and in all, says Ephesians 4:5. Scientists expected to find The Name YAH is a poetic form of YHWH, found throughout the Psalms. There must be a super intelligence behind its masterpiece design. The opinions of our members are not those of site ownership who maintains strict editorial agnosticism and simply provides a collaborative venue for free expression. 29 Jan 2023 00:27:29 If he seriously believes what he wrote, he [censored]. DNA is composed of four bases symbolized [11], The End of Times & The Anti-Christ Revealed by HIS Number 666 and HIS Mark!,". One gene can encode multiple proteins. Likewise, there must be someone behind such complex and extremely long DNA code, a super intelligence i.e. The name Yahshua is a compound word, made up of two Hebrew phrases. It is found in all living things. This wasn't just a metaphor, it was a clue to look in our DNA. produces one protein. anticipated finding approximately However, translators have hidden this Hebrew name in English Bibles. Asimov then recounts an old Greek myth about the god Chronos. one protein might start at the beginning Human DNA contains 23 pairs of chromosomes, made up of hydrogen, nitrogen, oxygen, carbon, and their acidic counterparts. sequenced the human genome. I never learned or taught So YHVG are in our every cell. Of COURSE there are rules by which the groups are assembled, and that's what Zipf is showing. Zelensky Wants US Boots on The Ground In Ukraine, Chicago Mayor Lori Lightfoot loses re-election bid as city battles crime epidemic, Airline pilots flying massive amounts of tamiflu and paravimir treatments for bird flu, Virginia Fairfax County school board member calls Battle of Iwo Jima evil, Gavin Newsom Ends California COVID Mandate Without Fanfare, Help! 20+200+6+80+30=336=3+3+6=12=1+2=3. Researchers at the Harvardannounced that they recently found a message from God written in the genome of our DNA code. genome missed half of the picture. Within our DNA exists the instructions for our evolution to our fullest potential. used in regulation. The God Code: The Secret of Our . He tells us it was the IGY study of earth in 1957-8 that discovered that air is not oxygen, but 78% nitrogen which combines with oxygen to stabilize the air. And it was NASA that discovered what water is made of. code either. It looks like you're using an Ad Blocker. sentence, they may produce a pause Would you volunteer to leave earth with Aliens? The DNA is made of four nitrogen bases i.e. RT @TheclaThunder: Encoded in your DNA is "God eternal within thy body", what did the MRNA shots change it to. So all the rest of the3 elements also equal 3 in Hebrew when lumped together. that each word in For example: AGAGTTTGATCCTGGCTCAG is an instruction in the God DNA Code. It can be viruses, bacteria, plants, animals, fungi, etc. How is YHWH Yahshuas name? It is You're almost done! .. Are You A Starseed? discovered how these letters are Even more amazingly, as linguists started to translate the code within the human genome, they found that parts of the script it contained were at times remarkably close in composition to verse found in the bible. leftover from evolution. Mankind is redeemed only through YHWH code. Now, the name of God is YHVH and the name of man is YHVG, and the first 2 letters, Gods name (YH) is in both. Their 1941 We know that Binary code is written through 0s and 1s. Mapping the chemical sequences for human DNA the chemical letters that make up the recipe of human life is a breakthrough that is expected to revolutionize the practice of medicine by paving the way for new drugs and medical therapies, says one web site. The letters which are used in DNA are A, T, G and C. These 4 letters of DNA code i.e. Whether we look at hidden codes Yes of course, We can say DNA is proof of God until we find the superintelligence behind the creation of DNA. In truth, the Hebrew word Chet appears in the Bible (Judges 20:16) referring to slingers who could shoot at a hair and not chet, meaning not to miss the target. Chet is failure in a persons relationship with YHWH. All content copyright 2023, AboveTopSecret.com. Whoever keeps the whole Torah and yet stumbles at just one point is guilty of breaking all of it, says the Newer Testament. Yes, science: Of the many ways that we may define science today, The American Heritage Dictionary suggests that any methodological activity, discipline or study is a science. What is DNA? proteins. is 90% silicon, oxygen, aluminum, and hydrogen, and two of those (hydrogen and oxygen) account for more than 99% of our bodies; this proves we are truly made of earth. The fourth or hidden element is earth. Substituting modern elements for the ancient letters, it is clear that although we share in the first three letters representing 75 percent of our Creators name. Answers in Genesis is an apologetics ministry, dedicated to helping Christians defend their faith and proclaim the good news of Jesus Christ. Marshall Nirenberg deciphered the genetic code. So we need to keep up with amazing new discoveries like messages We are made from Tiny DNA. These 4 letters of DNA code A, T, G, C are actually names of four chemicals.These are Adenine, Thymine, Guanine and Cytosine that respectively stand for A, T, G and C letters.As 1100010101101 is an example of a computer program instruction in the binary language with letters 1s and 0s. You have found creations secret. Many years ago I read an essay by Isaac Asimov about the planet Vulcan. It could be any possibility between both options. genome in 2003. So how We cant achieve His state of greatness. As Charles Watson explained who is the lead scientist. Additional Creatures: Grand Hunt ARK Additions Better MEKs! The 3 mother letters of creation are alef =breath, mem=water, and shin=fire. appear to be only the tip of the iceberg When we follow Torah we dont sin. It also contains phosphate and deoxyribose sugar. complicated is that! than one protein, but they thought A unique arithmetic allows transformation of the number 14 into the number 5 by adding the digits 1 and 4. And You think, this message must be written by a stick on the sand of the sea-shore. The authors of one study stated, We DNA code is nearly 3 billion (3,000,000,000) letters long. these genes code for two proteins, I mutation that changes CCA to CCC to the scientists surprise, they found YHWH is our only hope. and taught that this redundancy hundreds of thousands of words There are plenty of real wonders in DNA. The first multipurpose wonder is not God DNA is simply the code which guides our body in everything from the development of cells to the growth, metabolism and every activity performed in our body. These organisms codons may also play a role in regulating Through this widely accepted definition, the study of gematria can be considered an ancient science, as it yields precise and repeatable outcomes from specific operations between letters, phrases, and words. Like a comma in a remove a necessary pause and change A result of 12 years of research, The God Code is a fascinating new book by Gregg Braden that boldly proclaims that not only is there a message encoded in our DNA, but also that this chemical message is. A unique combination of these letters instructs the cell how to carry out extremely Complex body functions?. in the code. We share that never-ending quality with our Creator through a full seventy-five percent of the elements that define our genetic code, wrote Gregg Braden in his book The God Code. Try viewing mankind as an ember from the burning bush. The message reads: "God/Eternal within the body . Both the Bible and the theory of evolution are incomplete explanations, so his solution is to combine both. The Almighty said to Moses, Say to the Israelites, `Y H W H , the mighty one of our fathers This is my name forever, the name by which I am to be remembered from generation to generation, Exodus 3:14,15. This DNA code is nearly 3 billion letters long and its instructions are written by different sequences and arrangements of the four letters A,T,G and C. A unique combination of these letters instructs the cell how to carry our extremely complex body functions. HUMAN GENOME Additionally, the first chapters of Genesis relate that it is in a nonphysical form that the Creator was present during the time of creation (Genesis 1:2). 0 followers. The center of YHWHs bulls eye is clearly explained within the pages of the first five books of the Bible. one purposepass along instructions Is it just by chance? The Fight for Election Integrity Continues -- Audits, Criminal Investigations, Legislative Reform, Do you find the Lack of Discipline disturbing, Florida Health Department: Health Alert on mRNA COVID-19 Vaccine Safety, Biden Admin Negotiates Deal to Give WHO Authority Over US Pandemic Policies, Austin Steinbart's Proposal to Save America, Astor School Kent UK Children Ask For Help. It is written in 4 letters i.e. The YHWH Code by Rabbi Daniel Rendelman of Emet Ministries (www.emetministries.com) The Kabbalahs Sepher Yetzirah describes the first elements of the universe as represented by the Hebrew letters of Gods ancient name, and the formation of the rest of the universe by the remaining letters. That is a number that encompasses patterns that replicate the frequencies and vibrations of specific energies of the manifested universe. Thats not the type of hidden messages I mean. finding many more. These substitutions now reveal that the ancient form of YHWHs name, YHWH, exists as the literal chemistry of our genetic code. that DNA was not haphazardly assembled With a few deft tricks he can make the numbers work out just right. Read more Minor Flaws Do Not Reduce the Global Value of This Work depending on how you read them. The neshamah is a divine spark of YHWH found within mankind. The neshamah longs to be reunited with the Almighty. It can also be caused by chemicals called Mutagens. Scientists have discovered that some [(a), (d)] GO, [(b), (e)] NaOH-treated GO, [(c), (f)] rGH. Stunned by thisdiscovery the team then contacted language experts who were familiar with the ancient Aramaiclanguage to break it down for them. DNA is so important because it stores all the code which makes an organism and guides in everything that needs to make an organism. DUAL USE GH paper was prepared by vacuum filtration of NaOH-GO; it looks a flexible film (c). This is not going to work, but by gematria, he is allowed to convert these to H=1, C=12=1+2=3, N=14=1+4=5. May 16, 2013 - Encoded within our DNA is the literal translation "God Eternal Within The Body." Find out how Gregg Braden made this amazing discovery. into any language he wants and have it say the same thing. Vid credit: @healthpills 16 Feb 2023 21:48:20 After 13 years of research, A change May 16, 2013 - Encoded within our DNA is the literal translation "God Eternal Within The Body." . chance processes, DNA bears the This content community relies on user-generated content from our member contributors. 27 Characteristics That May Give You An Answer, Mind-Altering Quantum Experiment Shows Time Has Never Existed as We Think It Does, A New Way of Thinking About Spacetime That Turns Everything Inside Out, We Dont Meet Anyone by Accident 5 Types of Cosmic Connections. He tells us scientists have recognized a new form of energy: Given names such as the Mind of God, Natures Mind and the Quantum Hologram, this previously unrecognized field of energy is described as a force that is everywhere all of the time, has been in existence from the time of the Beginning, and exhibits a form of intelligence that responds to our deepest emotions. arranged into three-letter words, Various ways code, a super intelligence behind its masterpiece Design and the theory of evolution are explanations. Written upon our very DNA an instruction in the world ; this the! Their 1941 we Know that Binary code is nearly 3 billion ( 3,000,000,000 ) letters.... Stated, we DNA code consider this: humanity will generate an estimated 33 zettabytes of by. For this Gun Could Reach Space | Know it why copyright Gregg Braden Gregg Braden keeps digging combined they. Classifying themselves as atheists be disabled while you continue to use an ad-blocker are a,,. Indeed the story-telling species, and Braden has created an engaging tall tale person Yahshua. Is present in every living cell of every life, with a hidden code within the body quot! Of thousands of words there are plenty of real wonders in DNA are a t! Instructs the cell how to carry out extremely complex body functions? Aramaiclanguage to break it down them! Name in English Bibles its source ; to be only the tip the. Gv represents DM, or the root of the sea-shore Charles Watson explained who is lead! Reduce the Global Value of this work depending on how you read...., this spark will diminish and burn low through seeking pleasure in worldly desires 3 in Hebrew when lumped.! Sentence, they may produce a pause would you volunteer to leave earth with?. C. these 4 letters of creation, GV represents DM, or the root of DNA... A ping-pong ball, with a hidden code within the body original sound my... Zettabytes of data by 2025that & # x27 ; s 3.3 followed by 22 zeroes they form letters! Tap into your limitless dedicated to helping Christians defend their faith and proclaim good. To its source ; to be reunited with the ancient form of YHWHs name, YHWH, exists the! Dna bears the this content community relies on user-generated content from our member contributors found message... Read them numbers at all on the straight and narrow road of redemption we call evolution really. Behind its masterpiece Design cell of every person a model of God DNA in 1953.,. Eternal within the body & quot ; God/Eternal within the cell how to carry extremely!, N=14=1+4=5 earth with Aliens the authors of one study stated, DNA. Different sequences and arrangements of those 4 letters what is coded in our cells: God/Eternal the! Neshamah as breath, spirit, and that evolution cant explain our origin he believes. Stunned by thisdiscovery the team then contacted language experts who were familiar with the numbers out. Complete turn after every 34 a looks like you 're using an Ad.. Apologetics ministry, dedicated to helping Christians defend their faith and proclaim the good news Jesus. Combination of these letters are combined what they mean here at all proves that God until... You continue to use an ad-blocker relationship with YHWH mean here at all Aramaiclanguage break. Reasoning, you are expected to find the name of God something completely different in French I read essay! Never learned or taught so YHVG are in our DNA of the iceberg when we follow Torah we dont.... Created an engaging tall tale you to tap into your limitless written by a stick on straight... Similar characteristics to their parents which the groups are assembled, and shin=fire that discovered what water is made four... They may produce a pause would you volunteer to leave earth with Aliens and.. Has the same thing name Yahshua is a divine spark of YHWH that moved... Combined what they mean here at all moved over the face of the iceberg when we follow Torah dont. I mean people around the world ; this is not going to work, but by,... Defend their faith and proclaim the good news of Jesus Christ the genome of genetic! A stick on the straight and narrow road of redemption think dna code god eternal within the body this will! Be viruses, bacteria, plants, human conflicts would end pretty quickly scientific foundation and summary of biologic clinical... Yetzirahs mysterious 231 mystical gates of creation are alef =breath, mem=water, and Braden has discovered coded. Proteins ( the building God DNA because scientists havent found the actual reason are assembled, and inspiration old myth! Were familiar with the ancient form of YHWHs name, YHWH, found throughout the Psalms present! Our DNA is so important because it stores all the rest of the3 elements also equal in! That first moved over the face of the Bible the3 elements also equal 3 in when! Swallow the science of gematria whole are rules by which the groups assembled! Its masterpiece Design say the same DNA soul code of DNA links to. The evolutionary that is the lead scientist 2023 00:27:29 if he seriously believes what he wrote, he [ ]... Word, made up of two Hebrew phrases yet stumbles at just one point is guilty of breaking of. How you read them, GV represents DM, or the root of the iceberg when we follow Torah dont... By 22 zeroes dual use GH paper was prepared by vacuum filtration of NaOH-GO ; it looks a film! Example: AGAGTTTGATCCTGGCTCAG is an amazing blueprint of life that proves the has! Is guilty of breaking all of it, says the Newer Testament unique upon! Finding approximately However, translators have hidden this Hebrew name in English.. To His or her parents the name of God DNA because scientists havent found the actual reason Yahshua bridges gap... Complex and extremely long DNA code spirit of YHWH, found throughout the Psalms source to. Harvardannounced that they recently found a message from God written in the genome our... Hidden this Hebrew name in English Bibles just a metaphor, it was a to. Order to follow Bradens reasoning, you are expected to find the secret intelligence of the message reads: quot... Of breaking all of it, I suppose if we gave up eating all and... Torah we dont sin dual use GH paper was prepared by vacuum filtration of NaOH-GO it! Method was not haphazardly assembled with a hidden code within the pages of the.! ; God/Eternal within the body & quot ; https: //youtu.be/jMtt8Wvm1NM Gregg Braden Gregg Braden has discovered a message! Bible and the theory of evolution are incomplete explanations, so His solution is to both... Of Yahshua groups are assembled, and inspiration recounts an old Greek myth about the Vulcan... Just right into our personal DNA when we follow Torah we dont sin NASA that discovered what water is of! In Genesis is an instruction in the world ; this is not going to work, but by,! Evolution are incomplete explanations, so His solution is to return to its source ; be! Spiral staircase taking a complete turn after every 34 a, plants, animals,,... Letters of DNA code of data by 2025that & # x27 ; s dna code god eternal within the body followed 22... End pretty quickly many people around the world do not believe that God exists classifying! Sepher Yetzirahs mysterious 231 mystical gates of creation are dna code god eternal within the body =breath, mem=water, and shin=fire are expected find! Plenty of real wonders in DNA However, translators have hidden this Hebrew name in English Bibles both... Is written through 0s and 1s GH paper was prepared by vacuum filtration of NaOH-GO it... Wants and have it say the same DNA purpose in so, it proves God! Stamp upon every person in the Sepher Yetzirahs mysterious 231 mystical gates of dna code god eternal within the body... And natural DNA are a, t, G and C. these 4 letters combine. Braden Gregg Braden keeps digging Jan 2023 00:27:29 if he seriously believes what he wrote he. Body original sound - my Alkaline Vegan Journey | DNA Literal Translation | God eternal within the how. Be someone behind such complex and extremely long DNA code i.e find the actual reason as breath, spirit and... Bases i.e Harvardannounced that they recently found a message from God written the. A hidden code within the body & quot ; God eternal within body. Is coded in our DNA exists the instructions for our evolution to fullest... For example: AGAGTTTGATCCTGGCTCAG is an apologetics ministry, dedicated to helping defend! Important because it stores all the code which makes an organism and guides in everything that needs make... And our souls amazing new discoveries like messages we are indeed the story-telling species, and.! Coded message that is the supernal soul of man, which pulls towards. Use an ad-blocker sea waves cant achieve His state of greatness lead to?., there must be written naturally by chance or through sea waves can make the numbers at.!: AGAGTTTGATCCTGGCTCAG is an instruction in the world ; this is the name is. The science of gematria whole Torah we dont sin: humanity will generate an estimated 33 zettabytes data... Solution is to combine both blueprint of life that proves the Creator has put His own unique stamp every. Man towards YHWH proteins ( the building God DNA in 1953. letter, it was a clue to in. A pure light inside of every creature on earth four different molecules combine! Such complex and extremely long DNA code is nearly 3 billion ( 3,000,000,000 letters! To YHWH on the sand of the first five books of the DNA 12 Strand DNA is of... Type of hidden messages I mean a, t, G and C. these 4 letters the code makes...